Review



px459 v2 plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc px459 v2 plasmid
    Px459 V2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459/HF-PX459+(V2)+(Plasmid+%23118632)/pmc13011211-62-7-9
    Average 93 stars, based on 23 article reviews
    px459 v2 plasmid - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: Functional interrogation of candidate cis -regulatory elements at the LDLR locus
    Article Snippet: Oligonucleotide sequences (Integrated DNA Technologies, Coralville IA) are provided in . .. CRISPR constructs were generated by ligation of phosphorylated and annealed oligonucleotides into BsmBI-digested pLentiCRISPRv2 [ ] (Addgene, Watertown MA, #52961) or pX459 [ ] (Addgene #62988) as previously described [ ]. .. Reporter constructs were generated by PCR amplification of the indicated noncoding sequence from genomic DNA or a plasmid template with primers designed to provide flanking homology arms for HiFi assembly into AgeI/SbfI-digested (New England Biolabs, Ipswich MA) pLS-SceI (Addgene #137725) as previously described [ ].

    Article Title: Radiotherapy synergizes with an inducible AAV-based immunotherapy platform to program local and systemic antitumor immunity
    Article Snippet: .. For CRISPR knockout, cells were transiently transfected with pX459 (Addgene, 62988) targeting control (GCGAGGTATTCGGCTCCGCG), Kiaa0319l (AAVR; CATTCACGTAGCCTTCCCCA), Jak1 (CAGCGGAGAGTATACAGCCG), Ifngr1 (CGACTTCAGGGTGAAATACG), B2m (AGTATACTCACGCCACCCAC) or Tmem173 (TATCTCGGAATCGAATGTTG) with Lipofectamine transfection reagent (Thermo Fisher Scientific, L3000015). ..

    Article Title: Functional interrogation of candidate cis-regulatory elements at the LDLR locus.
    Article Snippet: Oligonucleotide sequences (Integrated DNA Technologies, Coralville IA) are provided in S10 Table. .. CRISPR constructs PLOS Genetics | https://doi.org/10.1371/journal.pgen.1012082 March 17, 2026 13 / 21 were generated by ligation of phosphorylated and annealed oligonucleotides into BsmBI-digested pLentiCRISPRv2 [61] (Addgene, Watertown MA, #52961) or pX459 [62] (Addgene #62988) as previously described [63]. .. Reporter constructs were generated by PCR amplification of the indicated noncoding sequence from genomic DNA or a plasmid template with primers designed to provide flanking homology arms for HiFi assembly into AgeI/SbfI-digested (New England Biolabs, Ipswich MA) pLS-SceI30 (Addgene #137725) as previously described [30].

    Construct:

    Article Title: Functional interrogation of candidate cis -regulatory elements at the LDLR locus
    Article Snippet: Oligonucleotide sequences (Integrated DNA Technologies, Coralville IA) are provided in . .. CRISPR constructs were generated by ligation of phosphorylated and annealed oligonucleotides into BsmBI-digested pLentiCRISPRv2 [ ] (Addgene, Watertown MA, #52961) or pX459 [ ] (Addgene #62988) as previously described [ ]. .. Reporter constructs were generated by PCR amplification of the indicated noncoding sequence from genomic DNA or a plasmid template with primers designed to provide flanking homology arms for HiFi assembly into AgeI/SbfI-digested (New England Biolabs, Ipswich MA) pLS-SceI (Addgene #137725) as previously described [ ].

    Article Title: Functional interrogation of candidate cis-regulatory elements at the LDLR locus.
    Article Snippet: Oligonucleotide sequences (Integrated DNA Technologies, Coralville IA) are provided in S10 Table. .. CRISPR constructs PLOS Genetics | https://doi.org/10.1371/journal.pgen.1012082 March 17, 2026 13 / 21 were generated by ligation of phosphorylated and annealed oligonucleotides into BsmBI-digested pLentiCRISPRv2 [61] (Addgene, Watertown MA, #52961) or pX459 [62] (Addgene #62988) as previously described [63]. .. Reporter constructs were generated by PCR amplification of the indicated noncoding sequence from genomic DNA or a plasmid template with primers designed to provide flanking homology arms for HiFi assembly into AgeI/SbfI-digested (New England Biolabs, Ipswich MA) pLS-SceI30 (Addgene #137725) as previously described [30].

    Generated:

    Article Title: Functional interrogation of candidate cis -regulatory elements at the LDLR locus
    Article Snippet: Oligonucleotide sequences (Integrated DNA Technologies, Coralville IA) are provided in . .. CRISPR constructs were generated by ligation of phosphorylated and annealed oligonucleotides into BsmBI-digested pLentiCRISPRv2 [ ] (Addgene, Watertown MA, #52961) or pX459 [ ] (Addgene #62988) as previously described [ ]. .. Reporter constructs were generated by PCR amplification of the indicated noncoding sequence from genomic DNA or a plasmid template with primers designed to provide flanking homology arms for HiFi assembly into AgeI/SbfI-digested (New England Biolabs, Ipswich MA) pLS-SceI (Addgene #137725) as previously described [ ].

    Article Title: Functional interrogation of candidate cis-regulatory elements at the LDLR locus.
    Article Snippet: Oligonucleotide sequences (Integrated DNA Technologies, Coralville IA) are provided in S10 Table. .. CRISPR constructs PLOS Genetics | https://doi.org/10.1371/journal.pgen.1012082 March 17, 2026 13 / 21 were generated by ligation of phosphorylated and annealed oligonucleotides into BsmBI-digested pLentiCRISPRv2 [61] (Addgene, Watertown MA, #52961) or pX459 [62] (Addgene #62988) as previously described [63]. .. Reporter constructs were generated by PCR amplification of the indicated noncoding sequence from genomic DNA or a plasmid template with primers designed to provide flanking homology arms for HiFi assembly into AgeI/SbfI-digested (New England Biolabs, Ipswich MA) pLS-SceI30 (Addgene #137725) as previously described [30].

    Article Title: Study of NSD2 using a dTAG system reveals their molecular mechanism and oncogenic implications in t(4;14) multiple myeloma.
    Article Snippet: Cells 126 were transfected with pX461-NSD2dTAG knock-in plasmid that harbors a sgRNA 127 targeting the start codon of NSD2 with X-tremeGENE HP (Roche). .. NSD2 knockout was 128 generated with pX459 (Addgene #62988) harboring a sgRNA targeting exon 4. ..

    Ligation:

    Article Title: Functional interrogation of candidate cis -regulatory elements at the LDLR locus
    Article Snippet: Oligonucleotide sequences (Integrated DNA Technologies, Coralville IA) are provided in . .. CRISPR constructs were generated by ligation of phosphorylated and annealed oligonucleotides into BsmBI-digested pLentiCRISPRv2 [ ] (Addgene, Watertown MA, #52961) or pX459 [ ] (Addgene #62988) as previously described [ ]. .. Reporter constructs were generated by PCR amplification of the indicated noncoding sequence from genomic DNA or a plasmid template with primers designed to provide flanking homology arms for HiFi assembly into AgeI/SbfI-digested (New England Biolabs, Ipswich MA) pLS-SceI (Addgene #137725) as previously described [ ].

    Article Title: Functional interrogation of candidate cis-regulatory elements at the LDLR locus.
    Article Snippet: Oligonucleotide sequences (Integrated DNA Technologies, Coralville IA) are provided in S10 Table. .. CRISPR constructs PLOS Genetics | https://doi.org/10.1371/journal.pgen.1012082 March 17, 2026 13 / 21 were generated by ligation of phosphorylated and annealed oligonucleotides into BsmBI-digested pLentiCRISPRv2 [61] (Addgene, Watertown MA, #52961) or pX459 [62] (Addgene #62988) as previously described [63]. .. Reporter constructs were generated by PCR amplification of the indicated noncoding sequence from genomic DNA or a plasmid template with primers designed to provide flanking homology arms for HiFi assembly into AgeI/SbfI-digested (New England Biolabs, Ipswich MA) pLS-SceI30 (Addgene #137725) as previously described [30].

    Plasmid Preparation:

    Article Title: HP1γ self-assembles and cooperates with KAP1 in repression of long noncoding RNA AI662270 in ESCs
    Article Snippet: pCAG-NLS-HA-Bxb1 , Addgene , Plasmid #51271. .. px459 , Addgene , Plasmid #62988. ..

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis.
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml−1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml−1 blasticidin.

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml −1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1 KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml −1 blasticidin.

    Knock-Out:

    Article Title: Radiotherapy synergizes with an inducible AAV-based immunotherapy platform to program local and systemic antitumor immunity
    Article Snippet: .. For CRISPR knockout, cells were transiently transfected with pX459 (Addgene, 62988) targeting control (GCGAGGTATTCGGCTCCGCG), Kiaa0319l (AAVR; CATTCACGTAGCCTTCCCCA), Jak1 (CAGCGGAGAGTATACAGCCG), Ifngr1 (CGACTTCAGGGTGAAATACG), B2m (AGTATACTCACGCCACCCAC) or Tmem173 (TATCTCGGAATCGAATGTTG) with Lipofectamine transfection reagent (Thermo Fisher Scientific, L3000015). ..

    Article Title: Study of NSD2 using a dTAG system reveals their molecular mechanism and oncogenic implications in t(4;14) multiple myeloma.
    Article Snippet: Cells 126 were transfected with pX461-NSD2dTAG knock-in plasmid that harbors a sgRNA 127 targeting the start codon of NSD2 with X-tremeGENE HP (Roche). .. NSD2 knockout was 128 generated with pX459 (Addgene #62988) harboring a sgRNA targeting exon 4. ..

    Transfection:

    Article Title: Radiotherapy synergizes with an inducible AAV-based immunotherapy platform to program local and systemic antitumor immunity
    Article Snippet: .. For CRISPR knockout, cells were transiently transfected with pX459 (Addgene, 62988) targeting control (GCGAGGTATTCGGCTCCGCG), Kiaa0319l (AAVR; CATTCACGTAGCCTTCCCCA), Jak1 (CAGCGGAGAGTATACAGCCG), Ifngr1 (CGACTTCAGGGTGAAATACG), B2m (AGTATACTCACGCCACCCAC) or Tmem173 (TATCTCGGAATCGAATGTTG) with Lipofectamine transfection reagent (Thermo Fisher Scientific, L3000015). ..

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis.
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml−1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml−1 blasticidin.

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml −1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1 KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml −1 blasticidin.

    Control:

    Article Title: Radiotherapy synergizes with an inducible AAV-based immunotherapy platform to program local and systemic antitumor immunity
    Article Snippet: .. For CRISPR knockout, cells were transiently transfected with pX459 (Addgene, 62988) targeting control (GCGAGGTATTCGGCTCCGCG), Kiaa0319l (AAVR; CATTCACGTAGCCTTCCCCA), Jak1 (CAGCGGAGAGTATACAGCCG), Ifngr1 (CGACTTCAGGGTGAAATACG), B2m (AGTATACTCACGCCACCCAC) or Tmem173 (TATCTCGGAATCGAATGTTG) with Lipofectamine transfection reagent (Thermo Fisher Scientific, L3000015). ..

    Selection:

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis.
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml−1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml−1 blasticidin.

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml −1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1 KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml −1 blasticidin.

    Isolation:

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis.
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml−1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml−1 blasticidin.

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml −1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1 KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml −1 blasticidin.

    Clone Assay:

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis.
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml−1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml−1 blasticidin.

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml −1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1 KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml −1 blasticidin.

    Cloning:

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis.
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml−1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml−1 blasticidin.

    Article Title: Vitamin B2 metabolism promotes FSP1 stability to prevent ferroptosis
    Article Snippet: .. Briefly, U-2 OS cells were transfected with px459 (Addgene, plasmid 48139) encoding FSP1 sgRNA guide 2, followed by selection in medium containing 1 μg ml −1 puromycin and isolation of individual clones using cloning rings. .. Expression lines were generated by transduction of U-2 OS FSP1 KO cells with pLenti CMV rtTA3 Blast (w756-1; a gift from E. Campeau; Addgene, plasmid 26429), followed by selection in medium containing 10 μg ml −1 blasticidin.



    Similar Products

    97
    Mirus Bio px459
    Px459, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459/TransIT+-293/bio_rxiv__64898__2026__04__01__715963-363-13-27
    Average 97 stars, based on 1 article reviews
    px459 - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    93
    Addgene inc px459 v2 plasmid
    Px459 V2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459/HF-PX459+(V2)+(Plasmid+%23118632)/pmc13011211-62-7-9
    Average 93 stars, based on 1 article reviews
    px459 v2 plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    Addgene inc px459 plasmid
    Px459 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pmc13034047-78-1-3
    Average 96 stars, based on 1 article reviews
    px459 plasmid - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc feng zhang
    Feng Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm41920822-295-17-20
    Average 96 stars, based on 1 article reviews
    feng zhang - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc pspcas9 bb 2a puro px459 v2 0
    Pspcas9 Bb 2a Puro Px459 V2 0, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm41896269-176-20-29
    Average 96 stars, based on 1 article reviews
    pspcas9 bb 2a puro px459 v2 0 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc pspcas9 bb 2a puro
    Pspcas9 Bb 2a Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pmc13001064-64-3-6
    Average 96 stars, based on 1 article reviews
    pspcas9 bb 2a puro - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc vector pspcas9 bb 2a puro
    Vector Pspcas9 Bb 2a Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/bio_rxiv__64898__2026__03__27__714679-182-17-19
    Average 96 stars, based on 1 article reviews
    vector pspcas9 bb 2a puro - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc px459 vector
    Px459 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px459/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm41889133-97-8-10
    Average 96 stars, based on 1 article reviews
    px459 vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results